5,557

Efflux Pump Mediated Antibiotic Resistance in Clinical Isolates of Helicobacter Pylori From South West Nigeria

Tolulope Funbi Jolaiya1, Muinah Adenike Fowora2, Charles Onyekwere3, Rose Ugiagbe4, Ifeanyi Ifeoma Agbo4, Olufunmilayo Lesi5, Dennis Amojuayi Ndububa6, Olusegun Adekanle6, Henry Akum Njom7, Ayodeji Idowu7, Isaac Adeyemi Adeleye1, Moses Bamidele2, Favour Ndidiamaka Ngoka2, *Stella Ifeanyi Smith2

1 Department of Microbiology, University of Lagos, Akoka, Lagos state, Nigeria;
2 Molecular Biology and Biotechnology Department, Nigerian Institute of Medical Research, Yaba, Lagos state, Nigeria;
3 Department of Medicine, Lagos State University Teaching Hospital, Ikeja, Lagos state, Nigeria;
4 Department of Medicine, University of Benin Teaching Hospital, Benin, Edo state, Nigeria;
5 Department of Medicine, Lagos University Teaching Hospital, Idi-Araba, Lagos state, Nigeria;
6 Department of Medicine, Obafemi Awolowo University Teaching Hospitals Complex, Ile-Ife, Osun state, Nigeria;
7 Department of Biochemistry and Microbiology, University of Fort Hare, Alice, Eastern cape, South Africa.

Conflict-of-interest statement: The authors declare that there is no conflict of interest regarding the publication of this paper.

Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http: //creativecommons.org/licenses/by-nc/4.0/

Correspondence to: Prof. Stella Ifeanyi Smith, Director of Research, Department of Molecular Biology and Biotechnology, Nigerian Institute of Medical Research, 6 Edmond Crescent, Yaba, Lagos, Nigeria.
Email: stellaismith@yahoo.com
Telephone: +08037058989

Received: May 10, 2020
Revised: July 12, 2020
Accepted: July 17, 2020
Published online: August 21, 2020

ABSTRACT

Introduction: Helicobacter pylori is a spiral shaped gram negative bacterium majorly causing peptic ulcers and gastric cancer in humans. The combinations of two or more antibiotics such as amoxicillin, clarithromycin, metronidazole or tetracycline with anti-secretory agents or bismuth have been used successfully for the treatment of H. pylori.

Aim: Increasing antibiotic resistance has been a contributory factor to treatment failures; as such evaluation of resistance mechanism will improve the management of H. pylori infection.

Methodology: The antibiotic resistance in H. pylori isolates from Nigeria was determined using E-test strips from Biomerieux SA, France and PCR for the efflux pump gene detection.

Results: Resistance to metronidazole was found to be 93% (97/104), amoxicillin 42% (44/104), clarithromycin 39% (41/104) and tetracycline 27% (28/104). However 51% (53/104) of the isolates harboured multidrug efflux pump gene hefA (Hp605) and 34% (35/104) hefD (Hp 971). However, hefG (Hp 1327) was absent in all the isolates. There was significant association between clarithromycin resistance and hefA with p-value 0.014, there was also association between amoxicillin resistance and hefD with p-value 0.004.

Conclusion: The present study revealed that H. pylori antibiotic resistance is on the increase in Nigerian strains and the mechanism of resistance may possibly include the possession of multidrug efflux pump.

Key words: Helicobacter pylori, E-test, Resistance, Efflux pump

© 2020 The Authors. Published by ACT Publishing Group Ltd. All rights reserved.

Jolaiya TF, Fowora MA, Onyekwere C, Ugiagbe R, Agbo II, Lesi O, Ndububa DA, Adekanle O, Njom HA, Idowu A, Adeleye IA, Bamidele M, Ngoka FN, Smith SI. Efflux Pump Mediated Antibiotic Resistance in Clinical Isolates of Helicobacter Pylori From South West Nigeria. Journal of Gastroenterology and Hepatology Research 2020; 9(4): 3283-3289 Available from: URL: http://www.ghrnet.org/index.php/joghr/article/view/2898

INTRODUCTION

Helicobacter pylori is a spiral shaped gram negative bacterium[1]. It is a major cause of peptic ulcer and gastric cancer in humans[2]. The combinations of two or more antibiotics such as amoxicillin, clarithromycin, metronidazole or tetracycline with anti-secretory agents or bismuth have been used successfully for treatment[3,4,5].

Antibiotic resistance is increasing worldwide with different geographical patterns and different prevalence of H. pylori. The meta-analysis program conducted by the Surveillance of H. pylori Antimicrobial Resistance Partnership (SHARP) between 1993 and 1999 demonstrated that metronidazole resistance was 36.9%, clarithromycin 10.1% while amoxicillin 1.4%[6]. In an investigation involving African countries from 1986 to 2017 antibiotic resistance was reported to be 75.8% for metronidazole, 72.6% amoxicillin, 48.7% tetracycline while it was 29.2% for clarithromycin[7]. However in Nigeria Harrison et al[8] reported an elevated metronidazole resistance rate of 99.1%, amoxicillin 33.3%, clarithromycin 14.4% and tetracycline 4.5%. Increased antibiotic resistance rates have been a contributory factor to treatment failures and multiple gene mutations are reported to play a role in high level of antibiotic resistance[9]. Different resistant strategies in bacteria to antibiotics have been reported which includes possession of active efflux pumps which excrete toxic chemical compounds and drugs out of the cell[10].

Opinions are divided over the actual mechanism by which this organism became resistant to antibiotics. These range from production of ß-lactamase[11], mutation or alterations in penicillin binding proteins[12,13], possession of active efflux pumps which excrete drugs[14] and decreased membrane permeability of antibiotics into the bacterial cells or combinations of these resistance strategies[15]. This current study attempts to evaluate the presence of multidrug efflux pump as a resistance mechanism in these isolates which could serve as target for reversing drug resistance in H. pylori.

MATERIALS AND METHODS

Study subjects

Four hundred and ninety-two outpatient subjects attending the endoscopic unit of Lagos State University Teaching Hospital (LASUTH), Lagos University Teaching Hospital (LUTH), University of Benin Teaching Hospital (UBTH) and Obafemi Awolowo University Teaching Hospitals Complex (OAUTHC) in Nigeria were recruited for the study after informed consent was obtained.

Collection and processing of samples

Biopsies were obtained from the stomach corpus and antrum of the patients and transported to the laboratory in Portagerm pylori (Biomerieux, Marcy l’Etoile, France) within two hours. The biopsies were cultured on serum plates prepared from GC agar (Difco) containing DENT antibiotic selective supplement (Oxoid, Basingstoke, United Kingdom) at pH 6.8 -7.0, vitamin mix (1%) and horse serum (9%). The cultures were incubated in a microaerophilic condition (85%N2, 10% CO2, 5% O2) at 37℃ for minimum of 3 days after which the serum plates were examined for possible growth of Helicobacter pylori strains. Rapid urease test was used for biochemical confirmation of the isolates[16].

Determination of the antibiotic minimum inhibitory concentrations (mics) of H. pylori isolates

MIC test was carried out on the isolates using amoxicillin, clarithromycin, metronidazole and tetracycline E-test strips (Biomerieux, Marcy l’Etoile, France), incubated for three to four days at 37℃ for visible colonies to form at microaerophilic atmosphere. Resistant values were taken with the break points as ˃ 0.125µg/mL, 0.5 µg/mL, 8.0 µg/mL and 1 µg/mL respectively determined by Eucast version 7.1 (2017)[17].

DNA extraction and PCR analysis

DNA was isolated from one hundred and four H. pylori isolates using QIAGEN DNA kit (Germany) following the manufacturer’s instructions. The extracted DNA was subjected to polymerase chain reaction (PCR) using FIREPol® DNA polymerase (Solis BioDyne, Tartu, Estonia) for the efflux pump genes with different primer pairs (Table 1). The PCR cycling conditions were as follows: 95°C for 5 min, then 30 cycles at 95°C for 30 s, 60°C for 45 s and extension at 72 °C for 1min[13].

Table 1 Primers used for the detection of multidrug resistance efflux pump genes.
Efflux pump genesSEQUENCESAMPLICON SIZE
HP0605F (hefA)ACGCCTCGAGTAAAAGCGCAAGGGAATTTG410bp
HP0605FR (hefA)ACGCTCTAGATTCGCTAATTGGCCTAGCAT 
HP0971F (hefD)ACGCCTCGAGAAACCAACGTGGAAACCAAA402bp
HP0971R (hefD)ACGCTCTAGACGCTTTGCAAATCCAAGAAT 
HP1327F (hefG)ACGCCTCGAGGAACTTTTGGTGCGTTGGAT327bp
HP1327R (hefG)ACGCTCTAGATTTGCTCCACCAATTTAGCC 
Source: Amsterdam et al. [24]

Ethical approval

Ethical approval was obtained from NIMR- IRB (registration number IRB/14/285)

Statistical analysis

SPSS version 21 was used to analyze the association between efflux pump and antibiotic resistance using Pearson chi-square and influence of efflux pump on antibiotic resistance using linear regression with the significant level set at p < 0.05.

RESULTS

The result of the antibiotic susceptibility testing showed that 93% (97/104) of the isolates were resistant to metronidazole, 42% (44/104) to amoxicillin, 39% (41/104) to clarithromycin and 27% (28/104) to tetracycline with resistant values equal or above the break points ˃ 0.125 µg/mL, 0.5 µg/mL, 8.0 µg/mL and 1 µg/mL for amoxicillin, clarithromycin, metronidazole and tetracycline respectively (Table 2). Analysis of the presence of efflux pump genes revealed that fifty three of the one hundred and four isolates (51%) possessed multidrug efflux pump gene hefA (Hp605) while thirty five (34%) possessed hefD (Hp971).However, none of the isolates possessed efflux pump gene hefG (Hp 1327) (Figures 1 and 2).

Figure 1 Agarose gel image of PCR products showing positive bands for hefA multidrug efflux pump gene, lane M: 100bp DNA marker, lane P12: positive control, lane J99 positive control, lane G27 positive, lane N: Negative control, lanes 1, 2, 4, 5 positive isolates for hefA gene, lane 3 negative for hefA gene.

Figure 2 Agarose gel image of PCR products showing positive bands for hefD multidrug efflux pump gene, lane M: 100bp DNA marker, lane G27 positive, lane N: Negative control, lanes 1 and 5 positive isolates for hefD gene, lane 2, 3, 4 and 6 negative for hefD gene.

Table 2 Susceptibility testing of H. pylori isolates by E-test.
Sample Identification NumberAmoxicillin Res≥0.12µg/MlClarithromycin?Res≥0.5µg/Ml Metronidazole?Res≥8 µg/Ml Tetracycline?Res≥1µg/Ml
N1-4A0.190.0162561.5
N1-4C0.190.0162560.016
N1-8A9102432
N1-8C41.125240.22
N1-18A100.192561.5
N1-18C100.192561.5
N1-24A0.2544200.25
N1-24C164320.22
N1-25A12162560.125
N1-25C960.032200.25
N1-26A0.0230.382560.19
N1-26C0.190.252560.32
N1-29C1603816256
N1-31C0.07256164
N1-45A0.150.03242
N1-45C160.0162412
N1-96A0.0470.0162560.047
N1-96C0.0470.0162560.064
N1-99A0.0160.0162560.016
N1-99C0.0160.192560.016
N1-102A0.191.52560.5
N1-102C0.191.52560.125
N1-103A0.190.0162560.38
N1-103C0.0160.0162560.016
N1-107A0.0320.0162560.016
N1-107C0.190.0162560.094
N1-123A0.1252562560.125
N1-123C0.192562560.094
N1-125A0.0232562560.032
N1-125C0.0232562560.094
N2-1A0.0860.2832562.095
N2-1C0.0860.2832562.095
N2-15A0.0160.0162560.016
N2-15C0.0160.0162560.064
N2-16A1.1250.625640.2135
N2-16C32.0950.07412.0320.44
N2-18A0.0160.0162560.016
N2-18C2560.382560.38
N2-26A2560.192561.5
N2-85A0.250.382560.125
N2-85C0.250.382560.125
N2-87C0.0160.0162564
N2-88A0.0160.0162560.19
N2-96A0.0160.0162560.125
N2-96C0.0160.192560.125
N2-97A0.04782560.125
N2-97C0.3862560.19
N2-98A0.0640.0162560.032
N2-98C0.0641.52560.38
N2-106A0.016256256256
N2-106C0.016256256256
N2-107A256256256256
N2-107C0.0162562560.016
N2-108A0.0190.0162560.064
N2-108C0.0940.0162560.125
N2-119A256256256256
N2-119C1225625616
N2-122A0.125162560.023
N2-122C0.1252562560.023
N2-123A0.0160.0162560.023
N2-123C0.0160.0162560.016
N2-130A0.0192562560.25
N2-130C0.0192562560.25
N2-136A0.250.0160.0160.016
N2-136C0.0160.0160.0160.016
N2-138A256256256256
N2-138C256256256256
N2-139A256256256256
N2-139C0.016256256256
N2-140A0.0322562560.032
N2-140C0.0162562560.016
N2-141C0.0160.0162560.064
N2-144A0.0160.0162560.125
N4-15A0.0160.0162560.064
N4-15C0.1250.0162560.094
N4-16C0.0190.25160.25
N4-19A0.0161.52560.07
N4-19C0.0160.092560.21
N4-29C0.380.140.190.32
N4-77A0.0640.0162560.094
N4-77C0.0640.0162560.094
N4-89A0.0160.0160.25256
N4-89C0.0160.0160.25256
N4-92A0.0160.0232560.016
N4-92C0.0160.0232560.016
N4-94A0.0160.016256256
N5-4A2560.016256256
N5-4C2560.016320.1575
N5-6A0.0160.0162560.5
N5-6C0.0160.0162560.5
N5-44A2560.1252560.125
N5-44C0.0232562560.125
N5-46A0.0640.0162560.38
N5-46C0.0640.0162560.38
N5-52A0.0640.0232560.75
N5-52C0.0160.0232560.5
N5-53A0.02382560.38
N5-53C0.1250.016256256
N5-54A0.0160.540.25
N5-61A2562562561
N5-61C0.06462560.016
N5-90A2562562560.38
N5-90C0.0160.016256256
N5-91C0.380.0160.0160.016
† RES -RESISTANT break point, Epsilometer test - E-test.

The multidrug resistance analysis showed that nine (8.7%) of the one hundred and four isolates were resistant to the four antibiotic used in the MIC test analysis. Three of these nine isolates harboured hefA which is 5.7% of the entire isolates that harboured hefA (3/53), similarly three out of this nine isolates harboured hefD which is 8.6% of the entire isolates that harboured hefD efflux pump gene (3/35) (Table 3). Twenty three of the one hundred and four (22.1%) isolates were resistant to three of the antibiotics, sixteen out of these twenty three isolates harboured hefA which is 30.1% of the entire isolates that harboured hefA (16/53), similarly three of these twenty three isolates harboured hefD which is 8.6% of the entire isolates that harboured hefD efflux pump gene (3/35) (Table 3). Thirty four of the one hundred and four (32.7%) isolates were resistant to two of the antibiotics at the same time, eighteen out of these thirty four isolates harboured hefA which is 34% of the entire isolates that harboured hefA (18/53). Similarly twelve of these thirty four isolates harboured hefD which is 34.2% of the entire isolates that harboured hefD efflux pump gene (12/35) (Table 3). Thirty seven of the one hundred and four (35.6%) isolates were resistant to one antibiotic, fifteen out of these thirty seven isolates harboured hefA which is 28.3% of the entire isolates that harboured hefA (15/53). Similarly seventeen of these thirty seven isolates harboured hefD which is 48.6% of the entire isolates that harboured hefD efflux pump gene (17/35) (Table 3). Only one isolate (0.96%) was sensitive to all the antibiotics, it harboured hefA but hefD was absent (Table 3).

Table 3 Multidrug Resistance Analysis and Frequency of Efflux Pump Genes hefA and hefD.
Multidrug (Amoxicillin, Clarithromycin, Metronidazole and Tetracycline)Frequency of resistant IsolateEfflux pump hefA frequencyEfflux pump hefD frequency
Resistance to 4 drugs8.7% (9/104)5.7% (3/53)8.6% (3/35)
Resistance to 3 drugs22.1% (23/104)30.1% (16/53)8.6% (3/35)
Resistance to 2 drugs32.7% (34/104)34% (18/53)34.2% (12/35)
Resistance to 1 drugs35.6% (37/104)28.3% (15/53)48.6% (17/35)
Sensitivity to all drugs0.96% (1/104)1.9% (1/53)0% (0/35)

Pearson chi-square (x2) analysis gave the association between antibiotic resistance and efflux pump genes hefA with p-values as follows 0.575, 0.572, 0.220 and 0.014 for tetracycline, amoxicillin, metronidazole and clarithromycin respectively. Similarly analysis of association between antibiotic resistance and efflux pump genes hefD gave p-values as follows 0.735, 0.506, 0.261 and 0.004 for association with clarithromycin, tetracycline, metronidazole and amoxicillin respectively (Table 4). The level of influence of the efflux pump genes on all the antibiotics determined by linear regression was r = 0.079 for hefA and r = 0.091 for hefD.

Table 4 Pearson chi-square - X2 analysis testing association of Drugs' resistance with efflux pump hefA and hefD.
AssociationP-values
Amoxicillin and hefA0.572
Clarithromycin and hefA0.014
Metronidazole and hefA0.22
Tetracycline and hefA0.575
Amoxicillin and hefD0.004
Clarithromycin and hefD0.735
Metronidazole and hefD0.261
Tetracycline and hefD0.506

DISCUSSION

The information on the antibiotic susceptibility patterns of H. pylori in Nigeria is relevant as a guide for the treatment options and efflux pump resistance mechanism in H. pylori may give a clue to acquired multidrug resistance mechanism[18].

It was observed in this study that there is an increase in resistance of the H. pylori isolates to amoxicillin, clarithromycin and tetracycline while metronidazole has decreased in resistance. This is in contrast to the observations in a previous study that reported metronidazole resistant rate of 99.1%, amoxicillin 33.3%, clarithromycin 14.4% and tetracycline 4.5% in H. pylori isolates from Nigeria[8]. Elsewhere in Brazil, there have been reports of 42% metronidazole resistance, 29% amoxicillin, 7% clarithromycin and tetracycline in dyspeptic patients[19]. Findings around the world for a period of 5 years (2009-2014) revealed antibiotic resistance range from 30.5%-75.02% for metronidazole, 2% - 40.87% amoxicillin, 5.46%-30.8% clarithromycin, 0%-50% for tetracycline and all these findings suggested a progressive increase in resistance rate which may inhibit eradication therapy of H. pylori infections[20].

This current study establish the presence of efflux pump genes in H. pylori strains from Nigeria, the hefA and hefD efflux pump genes have been identified in H. pylori isolates from Nigeria but hefG was absent, this finding is in agreement with the study carried out by Liu et al[18] who reported that hefA and hefD genes were detected in multidrug resistant H. pylori isolates and they also fail to detect hefG[18]. The absence of hefG genes had been attributed to the presence of a regulatory mechanism controlling the expression of the gene[21,22].

The increased presence of efflux pump genes hefA (69.8%) and hefD (51.4%) in multidrug resistance H. pylori isolates is consistent with the findings of Liu et al[18], who reported increased detection of efflux pump genes, according to the author these genes play important role in multidrug resistance of H. pylori with statistical analysis showing efflux pump gene hefA was associated with clarithromycin (p-value = 0.014) and hefD with amoxicillin (p-value=0.004)[18]. Huang et al[23] also confirmed that the presence of hefA genes can confer multidrug resistance on H. pylori. These authors treated selected multidrug resistant H. pylori with hefA genes with emodin, baicalin, schizandrin, berberine which inhibited the expression of hefA; they observed a significant decrease in the minimum inhibitory concentration value of H. pylori to amoxicillin and tetracycline[23].

Similarly the discovery from the other studies by Bina et al[21] and Kutschke and Jonge[22] also confirmed the presence of hefD in H. pylori isolates from Australia, Sweden, Argentina, the United States and Canada which was 34% in Nigerian isolates[21,22]. Harrison et al reported the absent of point mutation of 23S rRNA in clarithromycin resistance however this study suggest the possible cause could be the presence of efflux pump genes[8].

This current study, which is the first on efflux pump antibiotic resistance mechanisms in Nigerian H. pylori isolates, indicated that efflux pump may be an important mechanism of resistance and should be considered in H. pylori resistant mechanism.

The present study revealed that resistance of H. pylori to antibiotics used in the management of dyspeptic ulcer is on the rise in Nigeria and also establish for the first time that the mechanism of resistance may be due to the presence of a multidrug efflux pump system.

Acknowledgements

The authors wish to acknowledge funding from the German Research Foundation (DFG) (HA 2697/18-1) awarded to Prof. R. Haas and Prof. S.I. Smith. We acknowledge Wolfgang Fischer and Pia Palamides for the support in the clinical studies. The photo documentation system used was a kind donation from Alexander von Humboldt to Prof. Stella Smith.

Authors’ contributions

Manuscript preparation and Clinical studies-JTF, Manuscript Editing and Clinical studies- AIA, SSI, NHA, Clinical studies - FMA, OC, UR, AII, LO, NDA, AO, IA, BM, NFN.

REFERENCES

1. Marshal BJ. Helicobacter pylori: A Primer for 1994. Gastroenterol. 1993; 1(4): 241-247. [PMID: 8055220]

2. Blaser MJ. Hypotheses on the Pathogenesis and Natural History of Helicobacter pylori -induced Inflammation. Gastroenterol. 1992; 102(2): 720-727. [PMID: 1732141]; [DOI: 10.1016/0016-5085(92)90126-j]

3. Graham DY. Antibiotic Resistance in Helicobacter pylori: Implications for Therapy. Gastroenterol. 1998; 115(5): 1272-1277. [PMID: 9797384]; [DOI: 10.1016/s0016-5085(98)70100-3]

4. Graham DY. Therapy of Helicobacter pylori: Current Status and Issues. Gastroenterol. 2000; 118: 52-58. [PMID: 10868895]; [DOI: 10.1016/s0016-5085(00)70003-5]

5. Graham DY, Shiotani A. New Concepts of Resistance in the Treatment of Helicobacter pylori Infections. Nat. Clin. Pract. Gastroenterol. Hepatol. 2008; 5(6): 321-331. [PMCID: PMC2841357]; [DOI: 10.1038/ncpgasthep1138]

6. Meyer JM, Silliman NP, Wang W, Siepman NY, Sugg JE, Morris D, Zhang J, Bhattacharyya H, King EC, Hopkins RJ. Risk Factors for Helicobacter pylori Resistance in the United States: The Surveillance of H. pylori Antimicrobial Resistance Partnership (SHARP) Study, 1993-1999. Ann. Intern. Med. 2002; 136(1): 13-24. [PMID: 11777360]; [DOI: 10.7326/0003-4819-136-1-200201010-00008]

7. Jaka H, Rhee JA, Ostlundh L, Smart L, Peck R, Mueller A, Kasang C, Mshana S. The Magnitude of Antibiotic Resistance to Helicobacter pylori in Africa and Identified Mutations which Confer Resistance to Antibiotics: Systematic Review and Meta-analysis. BMC Infect. Dis. 2018; 18(1): 193. [PMCID: PMC5921563]; [DOI: 10.1186/s12879-018-3099-4]

8. Harrison U, Fowora MA, Seriki AT, Loell E, Mueller S, Ugo‒Ijeh M, Onyekwere CA, Lesi OA, Otegbayo JA, Akere A, Ndububa DA, Adekanle O, Anomneze E, Abdulkareem FB, Adeleye IA, Crispin A, Rieder G, Fischer W, Smith SI and Haas R. Helicobacter pylori Strains from A Nigerian Cohort Show Divergent Antibiotic Resistance Rates and A Uniform Pathogenic Profile. PloS One 2017; 12(5): e0176454. [PMCID: PMC5413034]; [DOI: 10.1371/journal.pone.0176454]

9. Qureshi NN, Gallaher B, Schiller NL. Evolution of Amoxicillin Resistance of Helicobacter pylori in vitro: Characterization of Resistance Mechanisms. Micro. Drug. Resist. 2014; 20(6): 509-516. [PMID: 24901497]; [DOI: 10.1089/mdr.2014.0019]

10. Jacoby GA, Archer GL. New Mechanisms of Bacteria Resistance to Antimicrobial Agents. N. Engl. J. Med 1991; 324 (9):601-612. [PMID: 1992321]; [DOI: 10.1056/NEJM199102283240906]

11. Livermore DM. ß-lactamases in Laboratory and Clinical Resistance. Clinic. Microbiol. Rev. 1995; 8(4): 557-584. [PMCID: PMC172876]

12. Goffin C, Ghuysen JM. Multimodular Penicillin-binding Proteins: An Enigmatic Family of Orthologs and Paralogs. Microbiol. Mol. Biol. Rev. 1998; 62(4): 1079-1093. [PMCID: PMC98940]

13. Gerrits MM, Godoy APO, Kuipers EJ, Ribeiro ML. Multiple Mutations in or Adjacent to the Conserved Penicillin-binding Protein Motifs of the Penicillin-binding Protein 1A Confer Amoxicillin Resistance to Helicobacter pylori. Helicobacter 2006; 11(3): 181-187. [PMID: 16684266]; [DOI: 10.1111/j.1523-5378.2006.00398.x]

14. Dore MP, Kwon DH, Sepulveda AR, El-Zimaity H, Yamaoka Y, Osato MS, Mototsugu K, Nieddu AM, Realdi G. Graham DY. Isolation of Helicobacter pylori from Sheep: Implications for Transmission to Humans. Am. J. Gastroenterol. 2001; 96(5): 1396-1401. [PMID: 11374673]; [DOI: 10.1111/j.1572-0241.2001.03772.x]

15. Nikaido H. Structure and Mechanism of RND-type Multidrug Efflux Pumps. Adv. Enzymol. Relat. Areas Mol. Biol. 2011; 77: 1-60. [PMCID: PMC3122131]; [DOI: 10.1002/9780470920541.ch1]

16. Jiang X, Doyle MP. Growth Supplements for Helicobacter pylori. Journal of Clinical Microbiology 2000; 38(5): 1984-1987. [PMCID: PMC 86644]

17. Ahmad N, Zakaria WR, Mohamed R. Analysis of Antibiotic Susceptibility Patterns of Helicobacter pylori Isolates from Malaysia. Helicobacter 2011; 16: 47-51. [PMID: 21241412]; [DOI: 10.1111/j.1523-5378.2010.00816.x]

18. Liu Z, Zheng P, Yang P. Efflux Pump Gene hefA of Helicobacter pylori Plays an Important Role in Multidrug Resistance. World J. Gastroenterol. 2008; 14(33): 5217-5222. [PMCID: PMC2744013]; [DOI: 10.3748/wig.14.5217]

19. Mendonca S, Ecclissato C, Sartori SM, Godoy AP, Guerzoni RA, Degger M, Pedrazzoli J. Prevalence of Helicobacter pylori Resistance to Metronidazole, Clarithromycin, Amoxicillin, Tetracycline and Furazolidone in Brazil. Helicobacter 2000; 5(2): 79-83. [PMID: 10849055]; [DOI: 10.1046/j.1523-5378.2000.00011.x]

20. Ghotaslou R, Leylabadlo HE, Asl YM. Prevalence of Antibiotic Resistance in Helicobacrter pylori: A Recent Literature Review. World J. Methodol. 2015; 5(3): 164-174. [PMCID: PMC4572030]; [DOI:10.5662/wjm.v5.i3.164]

21. Bina JE, Alm RA, Uria-Nickelsen M, Thomas SR, Trust TJ, Hancock RE. Helicobacter pylori Uptake and Efflux: Basis for Intrinsic Susceptibility to Antibiotics in vitro. Antimicrob. Agents. Chemother. 2000. 44: 248-254. [PMCID: PMC89666]; [DOI: 101128/aac.44.2]

22. Kutschke A, de Jonge BL. Compound Efflux in Helicobacter pylori. Antimicrob. Agents. Chemother. 2005. 49: 3009-3010. [PMCID: PMC1168643]; [DOI:10.1128/AAC.49.7]

23. Huang YQ, Huang GR, Wu MH, Tang HY, Hung ZS, Zhou XH, Yu WQ, Su JW, Mo XQ, Chen BP, Zhao LJ, Huang XF, Wei HY, Wei LD. Inhibitory Effects of Emodin, baicalin, Schizandrin and Berberine on hefA genes: Treatment of Helicobacter pylori-induced Multidrug Resistance. World J. gastroenterol. 2015; 21: 4225-4231. [PMCID: PMC4394083]; [DOI:10.3748/wig.v21.i14.4225]

24. Amsterdam KV, Bart A, Ende AVD. A Helicobacter pylori Tolc Efflux Pump Confers Resistance to Metronidazole. Antimicrob. Agents Chemother. 2005; 49(4): 1477-1482. [PMCID: PMC1068630]; [DOI:10.1128/AAC.49.4]

Refbacks

  • There are currently no refbacks.


Creative Commons License
This work is licensed under a Creative Commons Attribution 3.0 License.